g-25 gel filtration mini spin columns (Promega)
90
Structured Review
Promega
g-25 gel filtration mini spin columns
G 25 Gel Filtration Mini Spin Columns, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g-25+gel+filtration+mini+spin+columns/g+50+column/pmc02519730-109-80-86
Average 90 stars, based on 1 article reviews
G 25 Gel Filtration Mini Spin Columns, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/g-25+gel+filtration+mini+spin+columns/g+50+column/pmc02519730-109-80-86
Average 90 stars, based on 1 article reviews
g-25 gel filtration mini spin columns - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Incubation:Article Title: Tethering telomeric double- and single-stranded DNA-binding proteins inhibits telomere elongation. Article Snippet: One-fifth of the reaction was removed to be used as an input control, and the remaining reaction mixture was diluted in 1 PBS supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubatedwith anti-FLAGM2-agarose affinity gel for 1 h. Resin was washed three times in 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM Hepes, pH 7.4, 2.5 M PBoli109 primer 5 -CCGTAAGCATTTCATTATTGGAATTCGAGCTCGT- TTTCGA, 1 mM EDTA, pH 8.0, 100 ng/ l bovine serum albumin) containing 10 nM G-strand oligonucleotide (T2AG3)5 or 10 nM 0.8 kbp double-stranded telomeric repeat DNA fragment, which was 32P-labeled with T4 polynucleotide kinase (Invitrogen) according to the manufacturer’s protocol and purified from unincorporated 32P with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1× PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5′CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) ( 4 ) and 10 nM of the G-strand oligonucleotide [(T 2 AG 3 ) 5 ] 32 P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5 CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTT TTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T2AG3)5] 32P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1 Article Snippet: Resin was then washed three times in 1 PBS for 5 min at room temperature, after which one-fifth of the immunoprecipitate was incubated for 30 min at room temperature in 20 l of binding buffer (4) containing 10 nM of a G-strand oligonucleotide [(T2AG3)5], which was 32P labeled by T4 polynucleotide kinase (Invitrogen) and purified from unincorporated 32P with Binding Assay:Article Title: Tethering telomeric double- and single-stranded DNA-binding proteins inhibits telomere elongation. Article Snippet: One-fifth of the reaction was removed to be used as an input control, and the remaining reaction mixture was diluted in 1 PBS supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubatedwith anti-FLAGM2-agarose affinity gel for 1 h. Resin was washed three times in 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM Hepes, pH 7.4, 2.5 M PBoli109 primer 5 -CCGTAAGCATTTCATTATTGGAATTCGAGCTCGT- TTTCGA, 1 mM EDTA, pH 8.0, 100 ng/ l bovine serum albumin) containing 10 nM G-strand oligonucleotide (T2AG3)5 or 10 nM 0.8 kbp double-stranded telomeric repeat DNA fragment, which was 32P-labeled with T4 polynucleotide kinase (Invitrogen) according to the manufacturer’s protocol and purified from unincorporated 32P with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1× PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5′CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) ( 4 ) and 10 nM of the G-strand oligonucleotide [(T 2 AG 3 ) 5 ] 32 P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5 CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTT TTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T2AG3)5] 32P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1 Article Snippet: Resin was then washed three times in 1 PBS for 5 min at room temperature, after which one-fifth of the immunoprecipitate was incubated for 30 min at room temperature in 20 l of binding buffer (4) containing 10 nM of a G-strand oligonucleotide [(T2AG3)5], which was 32P labeled by T4 polynucleotide kinase (Invitrogen) and purified from unincorporated 32P with Labeling:Article Title: Tethering telomeric double- and single-stranded DNA-binding proteins inhibits telomere elongation. Article Snippet: One-fifth of the reaction was removed to be used as an input control, and the remaining reaction mixture was diluted in 1 PBS supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubatedwith anti-FLAGM2-agarose affinity gel for 1 h. Resin was washed three times in 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM Hepes, pH 7.4, 2.5 M PBoli109 primer 5 -CCGTAAGCATTTCATTATTGGAATTCGAGCTCGT- TTTCGA, 1 mM EDTA, pH 8.0, 100 ng/ l bovine serum albumin) containing 10 nM G-strand oligonucleotide (T2AG3)5 or 10 nM 0.8 kbp double-stranded telomeric repeat DNA fragment, which was 32P-labeled with T4 polynucleotide kinase (Invitrogen) according to the manufacturer’s protocol and purified from unincorporated 32P with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1× PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5′CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) ( 4 ) and 10 nM of the G-strand oligonucleotide [(T 2 AG 3 ) 5 ] 32 P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5 CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTT TTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T2AG3)5] 32P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1 Article Snippet: Resin was then washed three times in 1 PBS for 5 min at room temperature, after which one-fifth of the immunoprecipitate was incubated for 30 min at room temperature in 20 l of binding buffer (4) containing 10 nM of a G-strand oligonucleotide [(T2AG3)5], which was 32P labeled by T4 polynucleotide kinase (Invitrogen) and purified from unincorporated 32P with Purification:Article Title: Tethering telomeric double- and single-stranded DNA-binding proteins inhibits telomere elongation. Article Snippet: One-fifth of the reaction was removed to be used as an input control, and the remaining reaction mixture was diluted in 1 PBS supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubatedwith anti-FLAGM2-agarose affinity gel for 1 h. Resin was washed three times in 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM Hepes, pH 7.4, 2.5 M PBoli109 primer 5 -CCGTAAGCATTTCATTATTGGAATTCGAGCTCGT- TTTCGA, 1 mM EDTA, pH 8.0, 100 ng/ l bovine serum albumin) containing 10 nM G-strand oligonucleotide (T2AG3)5 or 10 nM 0.8 kbp double-stranded telomeric repeat DNA fragment, which was 32P-labeled with T4 polynucleotide kinase (Invitrogen) according to the manufacturer’s protocol and purified from unincorporated 32P with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1× PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5′CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) ( 4 ) and 10 nM of the G-strand oligonucleotide [(T 2 AG 3 ) 5 ] 32 P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5 CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTT TTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T2AG3)5] 32P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1 Article Snippet: Resin was then washed three times in 1 PBS for 5 min at room temperature, after which one-fifth of the immunoprecipitate was incubated for 30 min at room temperature in 20 l of binding buffer (4) containing 10 nM of a G-strand oligonucleotide [(T2AG3)5], which was 32P labeled by T4 polynucleotide kinase (Invitrogen) and purified from unincorporated 32P with Filtration:Article Title: Tethering telomeric double- and single-stranded DNA-binding proteins inhibits telomere elongation. Article Snippet: One-fifth of the reaction was removed to be used as an input control, and the remaining reaction mixture was diluted in 1 PBS supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubatedwith anti-FLAGM2-agarose affinity gel for 1 h. Resin was washed three times in 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM Hepes, pH 7.4, 2.5 M PBoli109 primer 5 -CCGTAAGCATTTCATTATTGGAATTCGAGCTCGT- TTTCGA, 1 mM EDTA, pH 8.0, 100 ng/ l bovine serum albumin) containing 10 nM G-strand oligonucleotide (T2AG3)5 or 10 nM 0.8 kbp double-stranded telomeric repeat DNA fragment, which was 32P-labeled with T4 polynucleotide kinase (Invitrogen) according to the manufacturer’s protocol and purified from unincorporated 32P with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1× PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5′CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) ( 4 ) and 10 nM of the G-strand oligonucleotide [(T 2 AG 3 ) 5 ] 32 P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5 CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTT TTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T2AG3)5] 32P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1 Article Snippet: Resin was then washed three times in 1 PBS for 5 min at room temperature, after which one-fifth of the immunoprecipitate was incubated for 30 min at room temperature in 20 l of binding buffer (4) containing 10 nM of a G-strand oligonucleotide [(T2AG3)5], which was 32P labeled by T4 polynucleotide kinase (Invitrogen) and purified from unincorporated 32P with Control:Article Title: Tethering telomeric double- and single-stranded DNA-binding proteins inhibits telomere elongation. Article Snippet: One-fifth of the reaction was removed to be used as an input control, and the remaining reaction mixture was diluted in 1 PBS supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubatedwith anti-FLAGM2-agarose affinity gel for 1 h. Resin was washed three times in 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM Hepes, pH 7.4, 2.5 M PBoli109 primer 5 -CCGTAAGCATTTCATTATTGGAATTCGAGCTCGT- TTTCGA, 1 mM EDTA, pH 8.0, 100 ng/ l bovine serum albumin) containing 10 nM G-strand oligonucleotide (T2AG3)5 or 10 nM 0.8 kbp double-stranded telomeric repeat DNA fragment, which was 32P-labeled with T4 polynucleotide kinase (Invitrogen) according to the manufacturer’s protocol and purified from unincorporated 32P with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1× PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5′CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) ( 4 ) and 10 nM of the G-strand oligonucleotide [(T 2 AG 3 ) 5 ] 32 P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Distinct Functions of POT1 at Telomeres Article Snippet: The resin was washed three times with 1 PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5 CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTT TTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T2AG3)5] 32P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with Article Title: Rescue of an hTERT Mutant Defective in Telomere Elongation by Fusion with hPot1 Article Snippet: Resin was then washed three times in 1 PBS for 5 min at room temperature, after which one-fifth of the immunoprecipitate was incubated for 30 min at room temperature in 20 l of binding buffer (4) containing 10 nM of a G-strand oligonucleotide [(T2AG3)5], which was 32P labeled by T4 polynucleotide kinase (Invitrogen) and purified from unincorporated 32P with |